Thermo Scientific Phage T7 RNA Polymerase is a DNA-dependent RNA polymerase with strict specificity for the corresponding double-stranded promoter . It catalyzes 5'→3' RNA synthesis downstream of single-stranded DNA or double-stranded DNA starting from the promoter.

Product Advantages

•Can incorporate modified nucleotides (such as aminoallyl, biotin, fluorescein, digoxigenin-labeled nuclei nucleotides)

Applications

Synthesis of unlabeled and labeled RNA for:

•Hybridization, in vitro RNA translation
•As a substrate in aRNA, siRNA, RNase protection experiments, and a template for genomic DNA sequencing
• In the study of RNA secondary structure and RNA-protein interaction, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA